Sheep Marker VH58 (1642)

Chromosome: 10 null

Locus: OARVH58

Marker Type: microsatellite

Database Name: GENBANK
Accession Number: L12546

Heterozygosity: 50
Informative Meioses: 153

Number of Alleles: 3

Annealing Temperature: 56°C
Forward Primer Sequence: ATTAAATGGAAAAAGAAAGTTAAAATCAGAACC
Reverse Primer Sequence: CAGATCTCCTTGCAGCCAAGGGAC

Linkage Group Assignment: null

Relative Position: 0cm


References:

419Title:OVINE MICROSATELLITES AT THE OARVH34,OARVH41,OARVH58,OARVH61 AND OARVH72 LOCI
Journal:ANIM GENET, 1993, Volume: 24, Page: 224
Authors:PIERSON, CA; HANRAHAN, V; EDE, AJ; CRAWFORD, AM;